View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_1D_high_28 (Length: 242)
Name: NF1457_1D_high_28
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_1D_high_28 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 23 - 242
Target Start/End: Complemental strand, 5265617 - 5265398
Alignment:
| Q |
23 |
gctcatttgcaagtaattcttatttctttacttttcttttaatgcttctgagcttaacaatttcgacatctttgacagttgagttaggttttgtgaacac |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5265617 |
gctcatttgcaagtaattcttatttctttacttttcttttaatgcttctgagcttaacaatttcgacatatttgacagttgagttaggttttgtgaacac |
5265518 |
T |
|
| Q |
123 |
atttctttaccattcaatcaagttattgttacactaattcgcttcttgattcatcctcctttcattttcagtatataacgctacttcggaagaccggtga |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5265517 |
atttctttaccattcaatcaagttattgttacactaattcgctgcttgattcatcctcctttcattttcagtatataacgctacttcggaaaaccggtga |
5265418 |
T |
|
| Q |
223 |
tgttgataaactgagaaaag |
242 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
5265417 |
tgttgataaactgagaaaag |
5265398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University