View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_1D_high_32 (Length: 209)
Name: NF1457_1D_high_32
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_1D_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 22 - 208
Target Start/End: Original strand, 40528127 - 40528313
Alignment:
| Q |
22 |
cagaaatagtttcagataatgccctttgacatctttctaggacagaaattgcagcagtcaaatcaccacgttctgcttcgactctagcctcagccattgc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40528127 |
cagaaatagtttcagataatgccctttgacatctttctaggacagaaattgcagcagtcaaatcaccacgttctgcttcgactctagcctcagccattgc |
40528226 |
T |
 |
| Q |
122 |
ctcagtagcttgaagtctattcctttgcctatctacttctattgatacaacttgatctctagccacattaggtctctgattcttcac |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40528227 |
ctcagtagcttgaagtctattcctttgcctatctacttctattgatacaacttgatctctagccacattaggtctctgaatcttcac |
40528313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 79 - 208
Target Start/End: Complemental strand, 35366124 - 35365995
Alignment:
| Q |
79 |
tcaaatcaccacgttctgcttcgactctagcctcagccattgcctcagtagcttgaagtctattcctttgcctatctacttctattgatacaacttgatc |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||||||| || |||||||||| |||||||||||||||| |||||||| ||||||| |
|
|
| T |
35366124 |
tcaaatcaccacgttctgcttcgactctagcctcaaccattgtctcagtagtttaaagtctattcatttgcctatctacttcggttgatacaccttgatc |
35366025 |
T |
 |
| Q |
179 |
tctagccacattaggtctctgattcttcac |
208 |
Q |
| |
|
|||||||||||||| ||||| | ||||||| |
|
|
| T |
35366024 |
tctagccacattagctctctcaatcttcac |
35365995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University