View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_1D_high_34 (Length: 203)
Name: NF1457_1D_high_34
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_1D_high_34 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 5e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 90 - 203
Target Start/End: Original strand, 49602416 - 49602529
Alignment:
| Q |
90 |
aagtaatcaaaacttgatatatccacatgttctcttagcagtatcacccatcttgcaatgctaatccttcaatgcatactaaactttaaatttctataca |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49602416 |
aagtaatcaaaacttgatatatccacatgttctcttagcagtatcacccatcttgcaatgctaatccttcaatgcatactaaactttaaatttctataca |
49602515 |
T |
|
| Q |
190 |
tgcatgacaactca |
203 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
49602516 |
tgcatgacaactca |
49602529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 34 - 71
Target Start/End: Original strand, 49602383 - 49602420
Alignment:
| Q |
34 |
agcaaaacaatacaacgtcttgagcaaataattaagta |
71 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49602383 |
agcagaacaatacaacgtcttgagcaaataattaagta |
49602420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University