View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_1D_low_26 (Length: 297)
Name: NF1457_1D_low_26
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_1D_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 251
Target Start/End: Complemental strand, 50958254 - 50958020
Alignment:
| Q |
17 |
gacatcaataggagttcaaaggatctagtatgaataagaacaaaacaacaagcttaaatttgcataaactattgatcatagcatgtttatgtagattaaa |
116 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |
|
|
| T |
50958254 |
gacatcaataggagtttaaaggatctagtatgaataagaacaaaacaacaagcttaaatttgcataaactagtgatcatagcatgtttatgtagattata |
50958155 |
T |
|
| Q |
117 |
ttaaaaatactgttgctggaaattttccctcccccttccattccttctacggttacggcgacgaccccctcttgcagccttcccaaattgatcacacttt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50958154 |
ttaaaaatactgttgctggaaattttccctcccccttccattccttctacggttacggcgatgaccccctcttgcagccttcccaaattgatcacacttt |
50958055 |
T |
|
| Q |
217 |
gtaaatatcccttggtccttcttattttggtttgt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
50958054 |
gtaaatatcccttggtccttcttattttggtttgt |
50958020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 17 - 87
Target Start/End: Complemental strand, 15856528 - 15856458
Alignment:
| Q |
17 |
gacatcaataggagttcaaaggatctagtatgaataagaacaaaacaacaagcttaaatttgcataaacta |
87 |
Q |
| |
|
||||| |||||||||| ||||||| |||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
15856528 |
gacattaataggagtttgtaggatcttttatgaataagaacaaaacgacaagcttaaagttgcataaacta |
15856458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 111 - 169
Target Start/End: Complemental strand, 15856404 - 15856346
Alignment:
| Q |
111 |
attaaattaaaaatactgttgctggaaattttccctcccccttccattccttctacggt |
169 |
Q |
| |
|
|||| |||||||| |||||||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
15856404 |
attatattaaaaagactgttgctggagttttcccctcccccttacattccttctacggt |
15856346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 182 - 229
Target Start/End: Complemental strand, 8155381 - 8155334
Alignment:
| Q |
182 |
cccctcttgcagccttcccaaattgatcacactttgtaaatatccctt |
229 |
Q |
| |
|
||||||||||||||||| ||||| |||||| ||||||||||||||||| |
|
|
| T |
8155381 |
cccctcttgcagccttcacaaatcgatcactctttgtaaatatccctt |
8155334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University