View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_1D_low_33 (Length: 278)
Name: NF1457_1D_low_33
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_1D_low_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 23333580 - 23333847
Alignment:
| Q |
1 |
ttgacatataaaaaatcacttacagttgcggtctcaagctctgcataatatgtattcagcaattgcatctcttgaagggaaagctcatcagcaacacgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333580 |
ttgacatataaaaaatcacttacagttgcggtctcaagctctgcataatatgtattcagcaatcgcatctcttgaagggaaagctcatcagcaacacgaa |
23333679 |
T |
 |
| Q |
101 |
caacagttcctgaggtaacgacaatgtgtacatttttcctggtaaatcatgacacaatatatcaaaacagcaaaaaattacataaaacaaacttatcaac |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333680 |
caacagttcctgaggcaacgacaatgtgtacatttttcctggtaaatcatgacacaatatatcaaaacagcaaaaaattacataaaacaaacttatcaac |
23333779 |
T |
 |
| Q |
201 |
ctctttgggggagtactgcttcagctgcattctggcacacaattttatcggtcaacttcgtgatgtcc |
268 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
23333780 |
ctcttggggggagtactgcttcagctgcattccggcacacaattttatcggtcaacttcgttatgtcc |
23333847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University