View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_1D_low_35 (Length: 271)
Name: NF1457_1D_low_35
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_1D_low_35 |
 |  |
|
| [»] chr6 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 204; Significance: 1e-111; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 52 - 271
Target Start/End: Original strand, 23332595 - 23332814
Alignment:
| Q |
52 |
atatgtggacgaatgagcgatagaagcgcatgaccgatccaccctcacgttggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
151 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332595 |
atatatggacgaatgagcgatagaagcgcatgaccgatccaccctcacgtgggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
23332694 |
T |
 |
| Q |
152 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacataagtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332695 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacatacgtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
23332794 |
T |
 |
| Q |
252 |
agctcagcccaaccagcccg |
271 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
23332795 |
agctcagcccaaccatcccg |
23332814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 15 - 57
Target Start/End: Original strand, 23322331 - 23322373
Alignment:
| Q |
15 |
gacatcaccaaacacaatcgttgtaaaatccaaacgcatatgt |
57 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
23322331 |
gacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23322373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 15 - 57
Target Start/End: Original strand, 23332498 - 23332540
Alignment:
| Q |
15 |
gacatcaccaaacacaatcgttgtaaaatccaaacgcatatgt |
57 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
23332498 |
gacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23332540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University