View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_1D_low_37 (Length: 264)
Name: NF1457_1D_low_37
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_1D_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 4 - 231
Target Start/End: Complemental strand, 6491599 - 6491368
Alignment:
| Q |
4 |
tggtgttgtccaatctggatatgaatccttattattaaagcacggtttgtatnnnnnnnnntcttagttggtgctgagaaaatgaacttctttcacaagg |
103 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6491599 |
tggtcttgtccaatctggatatgaatccttattattaaagcacggtttgtataaaaaaaa-tcttagttggtgctgagaaaatgaacttatttcacaagg |
6491501 |
T |
|
| Q |
104 |
gttctagtattatccaacaatgttttcaccgtcgtcgtcgtccctaatttgagcat--------tccatatgaagtgaacaaaatgatataatgataaat |
195 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6491500 |
gttctagtattatccaacaatgtattcaccgtcgt---cgtccctaatttgagcatattgatcctccatatgaagtgaacaaaatgatataatgataaat |
6491404 |
T |
|
| Q |
196 |
ttcaagcaaattggtataaatttgttcgattctact |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6491403 |
ttcaagcaaattggtataaatttgttcgattctact |
6491368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University