View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_1D_low_41 (Length: 251)
Name: NF1457_1D_low_41
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_1D_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 5 - 152
Target Start/End: Original strand, 21307931 - 21308078
Alignment:
| Q |
5 |
agtttggtgttggtggttaaagttgaacttaaatatttacgggatatgaaccaacttcttcccaacttaaccaaccatccaaggttggtctttaaatgat |
104 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21307931 |
agtttgatgttgatggttaaagttgaacttaaatatttacgggatatgaaacaacttcttcccaacttaaccaaccatccgaggttggtctttaaatgat |
21308030 |
T |
 |
| Q |
105 |
tactctttcttgttttttcacttgtttatgtttaactaaaaataatac |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21308031 |
tactctttcttgttttttcacttgtttatgtttaactaaaaataatac |
21308078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 183 - 245
Target Start/End: Original strand, 21308106 - 21308168
Alignment:
| Q |
183 |
caacacttgaaattgttgtgaattctcaaaccctggtacaaacgcaataacaatgcatgacgt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21308106 |
caacacttgaaattgttgtgaattctcaaaccctggtacaaaagcaataacaatgcatgacgt |
21308168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University