View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_1D_low_43 (Length: 246)
Name: NF1457_1D_low_43
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_1D_low_43 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 6 - 246
Target Start/End: Complemental strand, 37292280 - 37292040
Alignment:
| Q |
6 |
agtagcatagatagtggttgttgttgaattgtagcatcaagaaggaacgaagcagctagttggttgcgaaatactgttggaaatgttggaggaaaagaca |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37292280 |
agtaacatagatagtggttgttgttgaattgtagcatcaagaaggaacgaagcagctagttggttgcgaaatactgttggaaatgttggaggaaaagaca |
37292181 |
T |
|
| Q |
106 |
tgttggatgaaccttctgaagaagatttcagaaatgcattgcgcagtggcattatcctttgtaatgctctcaacaaaattcaacctggtgctgttcccaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37292180 |
tgttggatgaaccttctgaagaagatttcagaaatgcattgcgcagtggcattatcctttgtaatgctctcaacaaaattcaacctggtgctgttcccaa |
37292081 |
T |
|
| Q |
206 |
ggtatatatatgcttcttgttggttatcatcaatgtagcgc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37292080 |
ggtatatatatgcttcttgttggttatcatcaatgtagcgc |
37292040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 45 - 212
Target Start/End: Original strand, 46213962 - 46214129
Alignment:
| Q |
45 |
agaaggaacgaagcagctagttggttgcgaaatactgttggaaatgttggaggaaaagacatgttggatgaaccttctgaagaagatttcagaaatgcat |
144 |
Q |
| |
|
|||||| | ||||||||| ||||||||||||| || |||||| |||||||| |||||| || | ||||||||||||||||||||| |||| | | |
|
|
| T |
46213962 |
agaaggtatgaagcagctggttggttgcgaaaaacggttggagtagttggagggaaagacttgccagctgaaccttctgaagaagattttagaatcggtt |
46214061 |
T |
|
| Q |
145 |
tgcgcagtggcattatcctttgtaatgctctcaacaaaattcaacctggtgctgttcccaaggtatat |
212 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||||||||||||||||| || || | |||||||||| |
|
|
| T |
46214062 |
tgcgcagtggaattgtcctctgtaatgctctcaacaaaattcaacctggagcagtactcaaggtatat |
46214129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University