View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_1D_low_56 (Length: 227)
Name: NF1457_1D_low_56
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_1D_low_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 5 - 222
Target Start/End: Complemental strand, 13299949 - 13299732
Alignment:
| Q |
5 |
tagattattcttgtgcctctcataacaaaagcaaaacaatcaactttgaaagacatgtatacatatgtatagcaacataaccnnnnnnnngaagccgtaa |
104 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13299949 |
tagattattattgagcctctcataacaaaagcaaaacaatcaactttgaaagacatgtatacatatgtatagcaacataaccaaaaaaaagaagccgtaa |
13299850 |
T |
|
| Q |
105 |
ttgaatggacttgctgcaagaggaggtgttgataagcatcaccaaacacctaatgttttgtcaattatttgctaaacaataattaagaaaatatgcaaag |
204 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13299849 |
ttgaatggacttgctgcaagaagaggtgttgataagcatcaccaaacacctaatgttttgtcaattatttgataaacaataattaagaaaatatgcaaag |
13299750 |
T |
|
| Q |
205 |
ttgatggacttttatgct |
222 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
13299749 |
ttgatggacttttatgct |
13299732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University