View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_1D_low_59 (Length: 219)
Name: NF1457_1D_low_59
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_1D_low_59 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 20 - 146
Target Start/End: Complemental strand, 31410131 - 31410007
Alignment:
| Q |
20 |
catcaggtggttttttgaaagcgatagtgaaatagttatcaaattggttaatggagttttagatctacctaggacttacttgggaaatttgataaagggt |
119 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31410131 |
catcaggtggttttt-gaaagcgatagtgaaatagttatcaaattggttaatagagttttagatctacctaggacttacttgggaaatttgataaaggg- |
31410034 |
T |
|
| Q |
120 |
tattaggaaaatgaaaggttccatcac |
146 |
Q |
| |
|
| ||||||| ||||||||||||||||| |
|
|
| T |
31410033 |
tgttaggaagatgaaaggttccatcac |
31410007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 31409984 - 31409939
Alignment:
| Q |
170 |
gttaggagagaaggtaattgggaggctcattttcttgctcaatttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31409984 |
gttaggagagaaggtaattgggaggctcattttcttgcccaatttg |
31409939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University