View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_1D_low_60 (Length: 219)
Name: NF1457_1D_low_60
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_1D_low_60 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 31 - 213
Target Start/End: Original strand, 31425360 - 31425542
Alignment:
| Q |
31 |
tttattgcacgttaatgtcgcattctttcatagttaatgatgttgataccatatcgtctgatacttaatcaacaataatttgtggttgggttttggttcc |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31425360 |
tttattgcacgttaatgtcgcattctttcatagttaatgatgttgataccatatcgtctgatacttaatcaacaataatttgtggttgggttttggttcc |
31425459 |
T |
|
| Q |
131 |
aatttatttatttttgtgacaaactaacaatttagttttttctcgtgaagtacgtaatattattttcgtggttttctaaagta |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31425460 |
aatttatttatttttgcgacaaactaacaatttagttttttctcatgaagtacctaatattattttcgtggttttctaaagta |
31425542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University