View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_1D_low_62 (Length: 218)
Name: NF1457_1D_low_62
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_1D_low_62 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 60 - 196
Target Start/End: Original strand, 42078812 - 42078948
Alignment:
| Q |
60 |
ttccgaagctttgatgtagatattatctggtataggaaatagaagtcgtgtgagacactaatatctacaaacttcattaaccatttaacctttatacatc |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42078812 |
ttccgaagctttgatgtagatattatctggtataggaaatagaagtcgtgtgagacactaatatctacaaacttcattaaccatttaacctttatacatc |
42078911 |
T |
 |
| Q |
160 |
tgaactataatttttgaaaagaataacatgttcacat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42078912 |
tgaactataatttttgaaaagaataacatgttcacat |
42078948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University