View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_1D_low_63 (Length: 216)
Name: NF1457_1D_low_63
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_1D_low_63 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 43 - 174
Target Start/End: Original strand, 30504271 - 30504402
Alignment:
| Q |
43 |
gaaattgtacacttatttccttatcaaagaacaagagatgttccaggtttcaggattcaatctctacttctaaatatttctcttccaccaaaacttgttt |
142 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30504271 |
gaaattctacacttatttccttatcaaagaacaagagatgttccaggtttcaggattcaatctctacttctaaatatttctcttccaccaaaacttgtta |
30504370 |
T |
 |
| Q |
143 |
ataaaaaataaagactgaattagaaactcatt |
174 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||| |
|
|
| T |
30504371 |
ataaaaaataaagattgaattagagactcatt |
30504402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University