View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_1D_low_64 (Length: 216)
Name: NF1457_1D_low_64
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_1D_low_64 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 12 - 216
Target Start/End: Complemental strand, 12086218 - 12086014
Alignment:
| Q |
12 |
atgaaaagctatcaaatgttcttctttcactatctgcagcttcattttataatggagtatcaccaaaaatggaaattgttgaatcatgtgaaagtattga |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12086218 |
atgaaaagctttcaaatgttcttcttccactatctgcagcttcattttataatggagtatcaccaaaaatggaaattgttgaatcatgtgaaagtattga |
12086119 |
T |
 |
| Q |
112 |
caaactcaatgcatatttgaaggcaagaaaagatgatgttggtgctggtgtacctggaaaattcttacatgctataattggatcagatgatgctggtaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12086118 |
caaactcaatgcatatttgaaggcaagaaaagatgatgttagtgctggtgtacctggaaaattcttacatgctataattggatcagatgatgctggtaat |
12086019 |
T |
 |
| Q |
212 |
ttttc |
216 |
Q |
| |
|
||||| |
|
|
| T |
12086018 |
ttttc |
12086014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University