View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_1D_low_67 (Length: 209)
Name: NF1457_1D_low_67
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_1D_low_67 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 11 - 181
Target Start/End: Original strand, 34464695 - 34464866
Alignment:
| Q |
11 |
actatagtagtgtgtcctacataatacaaaaaataaactataggtgatgttgtaacnnnnnnnnnnnn-tactattaggtaggtgtggtgtgtctaggat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||||||| |
|
|
| T |
34464695 |
actatagtagtgtgtcctacataatacaaaaaataaactataggtgatgttgtaacaaaaacaaaaaaatactattaggtgggtgtggtatgtctaggat |
34464794 |
T |
|
| Q |
110 |
agacgtatgacaattgcaaatatgtttaggtcatattttcggacacaatatcaaattatcaatatagtttgt |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34464795 |
agacgtatgacaattgcaaatatgtttaggtcatattttcggacacaatatcaaattatcaatatagtttgt |
34464866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University