View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1457_1D_low_70 (Length: 203)

Name: NF1457_1D_low_70
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1457_1D_low_70
NF1457_1D_low_70
[»] chr4 (2 HSPs)
chr4 (90-203)||(49602416-49602529)
chr4 (34-71)||(49602383-49602420)


Alignment Details
Target: chr4 (Bit Score: 114; Significance: 5e-58; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 90 - 203
Target Start/End: Original strand, 49602416 - 49602529
Alignment:
90 aagtaatcaaaacttgatatatccacatgttctcttagcagtatcacccatcttgcaatgctaatccttcaatgcatactaaactttaaatttctataca 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49602416 aagtaatcaaaacttgatatatccacatgttctcttagcagtatcacccatcttgcaatgctaatccttcaatgcatactaaactttaaatttctataca 49602515  T
190 tgcatgacaactca 203  Q
    ||||||||||||||    
49602516 tgcatgacaactca 49602529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 34 - 71
Target Start/End: Original strand, 49602383 - 49602420
Alignment:
34 agcaaaacaatacaacgtcttgagcaaataattaagta 71  Q
    |||| |||||||||||||||||||||||||||||||||    
49602383 agcagaacaatacaacgtcttgagcaaataattaagta 49602420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University