View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_1D_low_72 (Length: 202)
Name: NF1457_1D_low_72
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_1D_low_72 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 20 - 186
Target Start/End: Original strand, 22933587 - 22933753
Alignment:
| Q |
20 |
ttttcatcgtaaaggctttctttgaggccaaaatcattcgtcttggcaatgatcttttggtatccgacgaacattttatttagtttttcaatcatggttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22933587 |
ttttcatcgtaaaggctttctttgaggccaaaatcattcgtcttggcaatgatcttttggtatccgacgaacattttatttagtttttcaattatggttc |
22933686 |
T |
|
| Q |
120 |
acattttaaatccttttacagatatttacgaatggaatttaccgaagcattgagcatcgaggaatag |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22933687 |
acattttaaatccttttacagatatttacgaatggaatttaccgaagcattgagcatcgaggaatag |
22933753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 127 - 180
Target Start/End: Original strand, 21351331 - 21351384
Alignment:
| Q |
127 |
aaatccttttacagatatttacgaatggaatttaccgaagcattgagcatcgag |
180 |
Q |
| |
|
|||||||||| |||||||| || || |||||||||||||||||||| ||||||| |
|
|
| T |
21351331 |
aaatccttttgcagatattaactaacggaatttaccgaagcattgaacatcgag |
21351384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 138 - 183
Target Start/End: Complemental strand, 22981587 - 22981542
Alignment:
| Q |
138 |
cagatatttacgaatggaatttaccgaagcattgagcatcgaggaa |
183 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||| |||||| |
|
|
| T |
22981587 |
cagatattaaccaatggaatttaccgaagcattgagcatagaggaa |
22981542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University