View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_2D_low_15 (Length: 259)
Name: NF1457_2D_low_15
Description: NF1457_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_2D_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 20 - 254
Target Start/End: Original strand, 40929941 - 40930175
Alignment:
| Q |
20 |
aggctgaagaggagggtgtgaccatggtggccacggtatcatcacaatttgtcttgagactcatctcctaatcacttttccacaaacatcacacgacaaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
40929941 |
aggctgaagaggagggtgtgaccatggaggccacggtatcatcacaatttgtcttgagactcatctcctgatcacttttccacaaacatcacacgacaga |
40930040 |
T |
 |
| Q |
120 |
tgtattaattaagagcattttgattaaaatacaagagaatctttttaacaggatttttaagaataaatgaagttctaattatcaccttttagataaaatt |
219 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40930041 |
tgtattaattaagagtattttgattaaaatacaagagaatctttttaataggatttttaagaataaatgaagttctaattatcaccttttagataaaatt |
40930140 |
T |
 |
| Q |
220 |
aggttgttatcttactggtggttgaaagcaaaatt |
254 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
40930141 |
aggttgttatcttactagtggttgaaagcaaaatt |
40930175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 253
Target Start/End: Complemental strand, 27287789 - 27287741
Alignment:
| Q |
205 |
cttttagataaaattaggttgttatcttactggtggttgaaagcaaaat |
253 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||| ||||| ||||||| |
|
|
| T |
27287789 |
cttttagataaaattaacttgttttcttactggtgattgaatgcaaaat |
27287741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 211 - 251
Target Start/End: Complemental strand, 17232706 - 17232666
Alignment:
| Q |
211 |
gataaaattaggttgttatcttactggtggttgaaagcaaa |
251 |
Q |
| |
|
|||||||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
17232706 |
gataaaataaagttgttatcttattggtggttgaaagcaaa |
17232666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University