View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_2D_low_17 (Length: 217)
Name: NF1457_2D_low_17
Description: NF1457_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_2D_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 5e-55; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 37090761 - 37090869
Alignment:
| Q |
1 |
ccctaaatgatgctcacaaagtgaataaccaacaagtgtttgttgacaacatctccatcctcttccattaacacgactgcaccttgaaccttccatcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37090761 |
ccctaaatgatgctcacaaagtgaataaccaacaagtgtttgttgacaacatctccatcctcttccattaacacgactgcaccttgaaccttccatcact |
37090860 |
T |
|
| Q |
101 |
gcacttccc |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
37090861 |
gcacttccc |
37090869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 37097128 - 37097236
Alignment:
| Q |
1 |
ccctaaatgatgctcacaaagtgaataaccaacaagtgtttgttgacaacatctccatcctcttccattaacacgactgcaccttgaaccttccatcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37097128 |
ccctaaatgatgctcacaaagtgaataaccaacaagtgtttgttgacaacatctccatcctcttccattaacacgactgcaccttgaaccttccatcact |
37097227 |
T |
|
| Q |
101 |
gcacttccc |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
37097228 |
gcacttccc |
37097236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 209
Target Start/End: Original strand, 37090927 - 37090963
Alignment:
| Q |
173 |
cccaaagaacacttcttattcatcttgatgtccatct |
209 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
37090927 |
cccaaagaacacttcttattcatcttggtgttcatct |
37090963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 23187339 - 23187434
Alignment:
| Q |
1 |
ccctaaatgatgctcacaaagtgaataaccaacaagtgtttgttgacaacatctccatcctcttccattaacacgactgcaccttgaaccttccat |
96 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||||||||| |||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
23187339 |
ccctaaatgatgctcacaaagagaataaccaactagggtttgttgacaacacctccatcctcttccattaactcgactgcaccgcgaaccttccat |
23187434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University