View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14580_high_1 (Length: 547)
Name: NF14580_high_1
Description: NF14580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14580_high_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 18 - 267
Target Start/End: Complemental strand, 4235590 - 4235341
Alignment:
| Q |
18 |
gaatgtgtttgaagggatatttaagagcaagttgtttttgggaattgttggtgtgacattggtgcttcaagttgtgatggttgagtttttgaaaaagttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4235590 |
gaatgtgtttgaagggatatttaagagcaagttgtttttgggaattgttggtgtgacattggtgcttcaagttgtgatggttgagtttttgaaaaagttt |
4235491 |
T |
|
| Q |
118 |
gctaatactgagaggttgaattggagagagtggattgtttgtattggttttgctgctgtttcttggccaattggatttgtggtgaagtttataccagtct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4235490 |
gctaatactgagaggttgaattggagagagtggattgtttgtattggttttgctgctgtttcttggccaattggatttgtggtgaagtttataccagtct |
4235391 |
T |
|
| Q |
218 |
cagataaaccattacttgattttttgaattttaggaagaaatattgaaga |
267 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
4235390 |
cagacaaacctttacttgattttttgaattttaggaaaagatattgaaga |
4235341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 146; Significance: 1e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 6184714 - 6184489
Alignment:
| Q |
18 |
gaatgtgtttgaagggatatttaagagcaagttgtttttgggaattgttggtgtgacattggtgcttcaagttgtgatggttgagtttttgaaaaagttt |
117 |
Q |
| |
|
|||||| |||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6184714 |
gaatgtctttgaaggaatattcaagagcaagttgtttttgggaattattggtgtgacattggtgcttcaagttgtgatggttgagtttttgaagaagttt |
6184615 |
T |
|
| Q |
118 |
gctaatactgagaggttgaattggagagagtggattgtttgtattggttttgctgctgtttcttggccaattggatttgtggtgaagtttataccagtct |
217 |
Q |
| |
|
||| ||| || ||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||||||||| ||| | |||||||| ||||| || | |
|
|
| T |
6184614 |
gctggtacagaaaggttgaattggagagaatggattatttgtattggttttggtgctgtttcttggccaattggttttcttgtgaagttgatacctgttt |
6184515 |
T |
|
| Q |
218 |
cagataaaccattacttgattttttg |
243 |
Q |
| |
|
||||||||||| | |||||||||||| |
|
|
| T |
6184514 |
cagataaaccacttcttgattttttg |
6184489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University