View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14580_low_9 (Length: 223)
Name: NF14580_low_9
Description: NF14580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14580_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 32 - 187
Target Start/End: Complemental strand, 9636248 - 9636093
Alignment:
| Q |
32 |
tttgaatttcaaaagcaagcacatatgcacaatggagacataataaaatggtaacaatgaaagataaaaatgttattaacaactgaaaatatttaaacaa |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9636248 |
tttgaatttcaaaagcaagcacatatgcacaatggagacataataaaatggtaacaatgaaagataaaaatgttattaacaactgaaaatatttaaacaa |
9636149 |
T |
 |
| Q |
132 |
aaacctcgagtaaaaatagctcgatgtgaaatagtacatataatggttctgataca |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9636148 |
aaacctcgagtaaaaatagctcgatgtgaaacagtacatataatggttctgataca |
9636093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University