View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14581_low_12 (Length: 274)

Name: NF14581_low_12
Description: NF14581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14581_low_12
NF14581_low_12
[»] chr7 (2 HSPs)
chr7 (138-228)||(48966374-48966463)
chr7 (227-262)||(48966496-48966531)


Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 138 - 228
Target Start/End: Original strand, 48966374 - 48966463
Alignment:
138 gtgatatgttagatgaatgacctttaccaaaattttcatgctaatcaatctatcaaatcatcatcttactatgatattgaggttatattct 228  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||| |||  |||||||||||||||||||||||||||||||||||    
48966374 gtgatatattagatgaatgacctttaccaaaattttcatgctaatcaatcaatc-tatcatcatcttactatgatattgaggttatattct 48966463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 227 - 262
Target Start/End: Original strand, 48966496 - 48966531
Alignment:
227 ctcctaaagtaacgtgctcattctttaattattatt 262  Q
    ||||||||||||||||||||||||||||||||||||    
48966496 ctcctaaagtaacgtgctcattctttaattattatt 48966531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University