View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14581_low_13 (Length: 269)
Name: NF14581_low_13
Description: NF14581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14581_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 6e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 75 - 254
Target Start/End: Original strand, 20053614 - 20053793
Alignment:
| Q |
75 |
atctccatcttcttttatctttgcccaccaccaatgactttgaccgaccgaaagtaaatagaaatatagcaacataaagaaatggacagaatagattaga |
174 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20053614 |
atctccgtcttcttttatctttgcccaccaccaatgactttgaccaaccgaaagtaaataaaaggatagcaacataaagaaatggacagaatagattaga |
20053713 |
T |
 |
| Q |
175 |
ttagagagaatagaaatgaagtgtaaagttaaaattagaattcaataaccatgtattgactgttacaaaaatagttgttg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20053714 |
ttagagagaatagaaatgaagtgtaaagttaaaattagaattcaataaccatgtatcgactgttacaaaaatagttgttg |
20053793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 20053550 - 20053586
Alignment:
| Q |
1 |
ccacacctttttactctatctattttcctctcctttt |
37 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||| |
|
|
| T |
20053550 |
ccacacctttttactctatctattttcatcacctttt |
20053586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University