View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14581_low_14 (Length: 260)
Name: NF14581_low_14
Description: NF14581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14581_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 10 - 219
Target Start/End: Original strand, 39908048 - 39908257
Alignment:
| Q |
10 |
attcaacctttgattttgactagaccgtgctaacttgtttaagttcctactaatccaagacagttcgcaacattattgcaaacatgctgcgtaattgttg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39908048 |
attcaacctttgattttgactagaccgtgctaacttgtttaagttcctactaatccaagacagttcgcaacattattgcaaacatgctgcgtaattgttg |
39908147 |
T |
 |
| Q |
110 |
ttatttgtttaacccccatctcatgaccttggtgagttgcgttaatattattannnnnnnatcaaggtgagttacactaattaataattcacgttaagcc |
209 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39908148 |
ttatttgtttaacccccatctcattaccttggtgagttgcgttaatattattatttttttatcaaggtgagttgcactaattaataattcacgttaagcc |
39908247 |
T |
 |
| Q |
210 |
aattttttat |
219 |
Q |
| |
|
|||||||||| |
|
|
| T |
39908248 |
aattttttat |
39908257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University