View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14581_low_17 (Length: 239)
Name: NF14581_low_17
Description: NF14581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14581_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 19172432 - 19172666
Alignment:
| Q |
1 |
tatgccagtcttggttgaggatttgagaagggtctgtggttgcagctgcgtcgagggtgtggtagtaagattggaagtgttggtggatgagctcaacgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19172432 |
tatgccagtcttggttgaggatttgagaagggtctgtgattgcagctgcgtcgagggtgtggtagtaagattggaagtgttggtggatgagctcaacgtg |
19172531 |
T |
 |
| Q |
101 |
agttgagaggagggttaaggaggcgccggagatagaacgacggagtaatgggaggtgattgttcttgagtgtgttgaaccattctgtgtagtattctttg |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19172532 |
agttgagaggagggttaaggagtcgccggagatagaacgacggagtaatgggaggtgattgttcttgagtgtgttgaaccattctgtgtagtattctttg |
19172631 |
T |
 |
| Q |
201 |
aatggacgcgacgtcgatgatgaagatgatgatgt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
19172632 |
aatggacgcgacgtcgatgatgaagatgatgatgt |
19172666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University