View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14581_low_3 (Length: 472)
Name: NF14581_low_3
Description: NF14581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14581_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 3e-46; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 8154025 - 8153927
Alignment:
| Q |
1 |
tacagttacaagctgtagcatttgtgtcttttgaatacttccatttgaaataactttatttttattagattgccctgccgtttcgagaatcttggaata |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8154025 |
tacagttacaagctgtagcatttgtgtcttttgaatacttccatttgaaataactttatttttaatagattgccctgccgtttcgagaatcttggaata |
8153927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 379 - 453
Target Start/End: Complemental strand, 8152906 - 8152832
Alignment:
| Q |
379 |
aattggacgcctcagatttttcacttattaaggcattcactttttgttgggtattgctataccaaaaaacccgac |
453 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8152906 |
aattggacggctcagatttttgacttattaaggcattcactttttgttgggtattgctataccaaaaaacccgac |
8152832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 288 - 346
Target Start/End: Complemental strand, 8153764 - 8153706
Alignment:
| Q |
288 |
gcttgagtctatggtagggtttaatatgagaaagttgagttctttcttatcataggaaa |
346 |
Q |
| |
|
||||||||||||||| || |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8153764 |
gcttgagtctatggtgggatttagtatgagaaagttgagttctttcttatcataggaaa |
8153706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 306 - 370
Target Start/End: Complemental strand, 4833929 - 4833865
Alignment:
| Q |
306 |
gtttaatatgagaaagttgagttctttcttatcataggaaagtttaaccaataccatagatataa |
370 |
Q |
| |
|
|||||||||| ||||| ||||||||||||| || |||||||| ||||| ||||||||||||| |
|
|
| T |
4833929 |
gtttaatatgggaaagaaaagttctttcttatgatgggaaagttcaaccacaaccatagatataa |
4833865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University