View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14582_high_4 (Length: 224)
Name: NF14582_high_4
Description: NF14582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14582_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 56 - 180
Target Start/End: Complemental strand, 39299332 - 39299208
Alignment:
| Q |
56 |
aatgtctttggaagagatagggaagtatagaaaccaagcacaacaaaatgaaatggacgcaatctcagcagcacaagagaggtatgaaaaagcaaagcaa |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299332 |
aatgtctttggaagagatagggaagtatagaaaccaagcacaacaaaatgaaatggacgcaatctcagcagcacaagagaggtatgaaaaagcaaagcaa |
39299233 |
T |
 |
| Q |
156 |
gcaacaaacgaaacactaaacaaca |
180 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39299232 |
gcaacaaacgaaacactaaacaaca |
39299208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University