View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14584_high_11 (Length: 244)
Name: NF14584_high_11
Description: NF14584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14584_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 225
Target Start/End: Original strand, 43116013 - 43116220
Alignment:
| Q |
18 |
atagtatggtgcatgaccaggaaagttattgtatccctgctggtatggggggtatccgtgtggaggtggtgggtaaggatgatagggtggtggctgtggg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43116013 |
atagtatggtgcatgaccaggaaagttattgtatccctgctggtatggggggtatccgtgtggaggtggtgggtaaggatgatagggtggtggctgtgga |
43116112 |
T |
|
| Q |
118 |
ccatggcaagggtaaccggtacccggtgggtaatacatcatattgggtgcggccatcggtggtgatgtgtctgtgtttgttgaagattgatgatcggagg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43116113 |
ccatggcaagggtaaccggtacccggtgggtaatacatcatattgggtgcggccaccggtggtgatgtgtctgtgtttgttgaagattgatgatcggagg |
43116212 |
T |
|
| Q |
218 |
tggatgat |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
43116213 |
tggatgat |
43116220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University