View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14584_low_12 (Length: 273)
Name: NF14584_low_12
Description: NF14584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14584_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 11534608 - 11534829
Alignment:
| Q |
18 |
agctttacggtttgtgaagaacttatgtgaggaacaaacatgtttaagctcgcaaagagatataaattgttgaaggacttgtaaattcgaaggaaaacaa |
117 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11534608 |
agctttatggtttgtgaagaacttatgtgaggaacaaacatgtttgagctcgcaaagagatataaattgttgaaggacttgtaaattcgaaggaaaacaa |
11534707 |
T |
|
| Q |
118 |
acttttatagcactatctaatatttgactcaagaacggtgctcttggagagttgtcccttctgtttgttcatataacatgttcgcatggtggagccaatg |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11534708 |
acttttctagcactatctaatatttgactcaagaacggtgctcttggagagttgtcccttctgtttgttcatataacatgttcgcatggtggagccaatg |
11534807 |
T |
|
| Q |
218 |
catgatgccctcgttgatgact |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
11534808 |
catgatgccctcgttgatgact |
11534829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 238 - 270
Target Start/End: Original strand, 11535761 - 11535793
Alignment:
| Q |
238 |
cttagtcatatgtcaatttcaacagtaaatatt |
270 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
11535761 |
cttagtcatatgtcaatttcaacattaaatatt |
11535793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University