View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14584_low_14 (Length: 248)
Name: NF14584_low_14
Description: NF14584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14584_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 18168712 - 18168935
Alignment:
| Q |
19 |
atcattctcaacatagctaccatcaaatttagtttcttcatttctctttctcccattagcttcattacttgaatcatcgctacgaagcacagacacaaac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
18168712 |
atcattctcaacatagctaccatcaaatttagtttcttcatttctctttctcccattagcttcattacttgaatcatcgctacgaagcacagacacagac |
18168811 |
T |
 |
| Q |
119 |
attggacacgacaatgatttctctttagagtgcatggccattagtggcaattcaagtgaaatagcactagaatttttgatgtctcttatatcttctaatg |
218 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18168812 |
attggacacgacaatgatttctcttctgagtgcatggccattagtggcaattcaagtgaaatagcactagaatttttgaagtctcttatatcttctaatg |
18168911 |
T |
 |
| Q |
219 |
aatgtttctcttcctttctctctg |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
18168912 |
aatgtttctcttcctttctctctg |
18168935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University