View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14584_low_16 (Length: 242)
Name: NF14584_low_16
Description: NF14584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14584_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 16 - 229
Target Start/End: Original strand, 4909530 - 4909755
Alignment:
| Q |
16 |
aatatcaataataatttgcttttgaatacaaatcaaacgattaccaaacaaaatcttattaaagctatttggttttaaccgttatgaaagcttattttct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4909530 |
aatatcaataataatttgcttttgaatacaaatcaaacgattaccaaacaaaatcttattaaagctatttggttttaaccgttatgaaagcttattttct |
4909629 |
T |
 |
| Q |
116 |
atgttagt-------------aagaaaatgagttcgagttatttagaattcgaccagtagataattaaaggttggtcaatataactactttagtgatgat |
202 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||| || ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4909630 |
atgttagttcatcgacttttaaagaaaatgagttcgagttatttagagttcgaccaataaataattaaaggtt-gtcaatataactactttagtgatgat |
4909728 |
T |
 |
| Q |
203 |
ttaaactatgattctcttgaatgattt |
229 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
4909729 |
ttaaactatgattctcttgaatgattt |
4909755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University