View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14584_low_6 (Length: 333)
Name: NF14584_low_6
Description: NF14584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14584_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 9 - 314
Target Start/End: Complemental strand, 43408344 - 43408038
Alignment:
| Q |
9 |
attatacttactagcaaaaagacgacccat-atagataatccaaacacaagattacattgcactacaatattatatttaactagcgtcatatatctttgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43408344 |
attatacttactagcaaaaagacgacccattatagataatccaaacacaagattacattgcactacaatattatatttaactagtgtcatatatctttga |
43408245 |
T |
 |
| Q |
108 |
tgtctagcttttgatcatgtcatctttaactaagcttgccagaaaagaaagagactgattagctactatattatagaaatttggtagaagaagcacgcag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408244 |
tgtctagcttttgatcatgtcatctttaactaagcttgccagaaaagaaagagactgattagctactatattatagaaatttggtagaagaagcacgcag |
43408145 |
T |
 |
| Q |
208 |
tgtgtgtctagagtagagacaatgaagatagtgtgtgtggccaagcatgtgtgtcttttttcttacttgtgtcaaagaatagcctgagcccttaacaaac |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408144 |
tgtgtgtctagagtagagacaatgaagatagtgtgtgtggccaagcatgtgtgtcttttttcttacttgtgtcaaagaatagcctgagcccttaacaaac |
43408045 |
T |
 |
| Q |
308 |
caggctg |
314 |
Q |
| |
|
||||||| |
|
|
| T |
43408044 |
caggctg |
43408038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University