View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14585_high_10 (Length: 266)
Name: NF14585_high_10
Description: NF14585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14585_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 43004046 - 43003795
Alignment:
| Q |
1 |
ttagttatttattcgctctctggaaaaatggatgtagcatctgatattcgtggttgggatgagttgatccccgatactttggcgctgattttcacgaaac |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43004046 |
ttagttatttattcactctctggaaaaatggaagtagcatctgatattcgtggttgggatgagttgatccccgatactttggcgctgattttcacgaaac |
43003947 |
T |
 |
| Q |
101 |
tttcactccgtgaaagattgaccgtgatcccaatggtatgcaaatcttgggccagtgctgtttatggaccttactgttggcaagagatagaaatcactga |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43003946 |
tttcactccgtgaaagattgaccatgatcccaatggtatgcaaatcttgggccagtgctgtttatggaccttactgttggcaagagatagaaatcactga |
43003847 |
T |
 |
| Q |
201 |
ctggag--cagcatttacgagcatcggaaaaatgagcggatggttcagatgt |
250 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43003846 |
ctggagcacagcatttacgagcatcggaaaaatgagcggatggttcagatgt |
43003795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 25 - 210
Target Start/End: Original strand, 27071506 - 27071691
Alignment:
| Q |
25 |
aaaatggatgtagcatctgatattcgtggttgggatgagttgatccccgatactttggcgctgattttcacgaaactttcactccgtgaaagattgaccg |
124 |
Q |
| |
|
||||||| ||| ||||||||||||||| |||||| ||||||||||| ||||| |||| ||||||||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
27071506 |
aaaatggcagtatcatctgatattcgtgcttgggacgagttgatccctgataccttggggctgattttcacgaaactttcgctctgtgaaagattcaccg |
27071605 |
T |
 |
| Q |
125 |
tgatcccaatggtatgcaaatcttgggccagtgctgtttatggaccttactgttggcaagagatagaaatcactgactggagcagc |
210 |
Q |
| |
|
||||||||| ||| |||||||| |||||||||||||| |||| ||||||||||||||||||||||| || ||||||||| ||||| |
|
|
| T |
27071606 |
tgatcccaagggtctgcaaatcatgggccagtgctgtaaatggtccttactgttggcaagagatagacataactgactggtgcagc |
27071691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University