View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14585_low_10 (Length: 315)

Name: NF14585_low_10
Description: NF14585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14585_low_10
NF14585_low_10
[»] chr3 (1 HSPs)
chr3 (7-174)||(44002035-44002195)


Alignment Details
Target: chr3 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 7 - 174
Target Start/End: Complemental strand, 44002195 - 44002035
Alignment:
7 agaatatcaagtgtacagtgtattcaagcataccataaataacgcaatattgcatgattgtgaactatttaaaatttaaaacacaatgagagaaccgacc 106  Q
    |||||||||| |||||||||||| ||||||||||||||    ||||||   |||||||||||||||||||||||||||||||||||||||||||||||||    
44002195 agaatatcaattgtacagtgtatccaagcataccataa----cgcaat---gcatgattgtgaactatttaaaatttaaaacacaatgagagaaccgacc 44002103  T
107 gctttaacaaataaaacaagtgaaaataatagcaatttgtcaaattttgtttcatcaaccattgatta 174  Q
    ||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
44002102 gctctaacaaataaaacaagtgaaaataatatcaatttgtcaaattttgtttcatcaaccattgatta 44002035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University