View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14585_low_12 (Length: 279)
Name: NF14585_low_12
Description: NF14585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14585_low_12 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 6 - 279
Target Start/End: Complemental strand, 43004362 - 43004083
Alignment:
| Q |
6 |
attctcctcaaaggttgttggttgagacaattgtggagcgtatcaagataaaggttttccaaatctcttgattcagtcacnnnnnnnatcttattttcct |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43004362 |
attctcctcaaaggttgttggttgagacaattgtggagcgtatcaagataaaggttttccaaatctcttgattcagtcactttttttatcttattttcct |
43004263 |
T |
 |
| Q |
106 |
catagacataagacatggtgaaaatgcttctttatattcatattcat------cttctattctaaccagctttgaaagtttcaatttatttctttgttct |
199 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43004262 |
cttagacataagacatggtgaaaatgcttctttatattcatattcatattcatcttctattctaaccagctttgaaagtttcaatttatttctttgttct |
43004163 |
T |
 |
| Q |
200 |
tgatttgtgtgtttagaatgattcttgaaaatctcttaaatatttgaatttaatcatggaaaattttgtttatgttgaac |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
43004162 |
tgatttgtgtgtttagaatgattcttgaaaatctcttaaatatttgaatttaatcatggaaaactttgttcatgttgaac |
43004083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University