View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14586_high_11 (Length: 348)
Name: NF14586_high_11
Description: NF14586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14586_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 173 - 331
Target Start/End: Complemental strand, 1639657 - 1639499
Alignment:
| Q |
173 |
aatgaaagttggtaaaatatgtcttagaaaatggcccttgaacacagtcacttaatgtccaaatggttgctaaaattattcattaattgtaggtaacatg |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
1639657 |
aatgaaagttggtaaaatatgtcttagaaaatggcccttgaacacagtcacttaatgtccaaatggttgctaaaaatattgattaattgtaggtaacatg |
1639558 |
T |
|
| Q |
273 |
aagcctcttagatgtcattgatgtgtcatccatatattgtgccgaaaaatgctcttctt |
331 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1639557 |
aaccctcttagatgtcattgatgtgtcatccatatattgtgccaaaaaatgctcttctt |
1639499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University