View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14586_high_28 (Length: 236)
Name: NF14586_high_28
Description: NF14586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14586_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 42929082 - 42929301
Alignment:
| Q |
1 |
ctcttctcaaaaacacagaactcaaatattcatcttcttcttcatcatggccatggccatattgtcaccaaccaaaaacactctcttttagagctgataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42929082 |
ctcttctcaaaaacacagaactcaaatattcatcttcttcttcatcatggccatggccatattgtcaccaaccaaaaacactctcttttagagctgataa |
42929181 |
T |
 |
| Q |
101 |
catcaacaaagatgacactttcaaaaccattaactcagtttacttggacgcttctgaatccttctccactgtttctccaaactgtgattctagcttttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42929182 |
catcaacaaagatgacactttcaaaaccattaactcagtttacttggatgcttctgaatccttctccactgtttctccaaactgtgattctagcttttca |
42929281 |
T |
 |
| Q |
201 |
aaagcttctaatgatcaaga |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42929282 |
aaagcttctaatgatcaaga |
42929301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 39 - 94
Target Start/End: Complemental strand, 25531550 - 25531495
Alignment:
| Q |
39 |
tcttcatcatggccatggccatattgtcaccaaccaaaaacactctcttttagagc |
94 |
Q |
| |
|
||||| |||||| | ||||||| |||| |||||||||||||||| ||||||||||| |
|
|
| T |
25531550 |
tcttcttcatggtcttggccatcttgtaaccaaccaaaaacactttcttttagagc |
25531495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University