View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14586_high_29 (Length: 236)
Name: NF14586_high_29
Description: NF14586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14586_high_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 15 - 185
Target Start/End: Original strand, 55386256 - 55386424
Alignment:
| Q |
15 |
aaaccaaatgttttgccttcaacataggagatatcacttatgcatccaggtggttagttagtttagctggtggctgcgccatggccctaacctagggggt |
114 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55386256 |
aaaccaaatgttttgacttcaacataggagatatcacttatgcatccaggtggttagttagtctagctggtggct--gccatggccctaacctagggggt |
55386353 |
T |
|
| Q |
115 |
tcaaacttttgagttttccgacctttcgagctaatagtgcnnnnnnntaaattagaggttcaaaatgtaaa |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
55386354 |
tcaaacttttgagttttccgacctttcgagctaatagtgcaaaaaaataaattagaggttcaaactgtaaa |
55386424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University