View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14586_high_36 (Length: 212)
Name: NF14586_high_36
Description: NF14586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14586_high_36 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 19 - 167
Target Start/End: Complemental strand, 32416556 - 32416408
Alignment:
| Q |
19 |
gaccctaccctctgcaaatgtaatgaaccgtgtattattttatttcaaataaattactataatcacataattttatactgcatccaatgcattattttgt |
118 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32416556 |
gaccctaccctctgcaaaagtaatgaaccgtgtattattttatttcaaataaattactataatcacataattttatattgcatccaatgcattattttgt |
32416457 |
T |
|
| Q |
119 |
tttgtcgatgcattattttcttggtaccaactttatgctataaaaacaa |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32416456 |
tttgtcgatgcattattttcttggtaccaactttatgctataaaaacaa |
32416408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 19 - 167
Target Start/End: Complemental strand, 32422397 - 32422249
Alignment:
| Q |
19 |
gaccctaccctctgcaaatgtaatgaaccgtgtattattttatttcaaataaattactataatcacataattttatactgcatccaatgcattattttgt |
118 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32422397 |
gaccctaccctctgcaaaagtaatgaaccgtgtattattttatttcaaataaattactataatcacataattttatattgcatccaatgcattattttgt |
32422298 |
T |
|
| Q |
119 |
tttgtcgatgcattattttcttggtaccaactttatgctataaaaacaa |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32422297 |
tttgtcgatgcattattttcttggtaccaactttatgctataaaaacaa |
32422249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University