View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14586_low_24 (Length: 297)
Name: NF14586_low_24
Description: NF14586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14586_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 16 - 252
Target Start/End: Original strand, 53556009 - 53556249
Alignment:
| Q |
16 |
aagaaggtacatggcacttgacatcata----agaatatgaacttaataattcgtacaatttagtcatgacggataagatgctagatttcattggtgtgt |
111 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
53556009 |
aagaaggtacatggctcttgacatcatatataagaatatgaacttaat--ttcgtacaatttagtcatgacggataagatggtagatttcattggtgtgt |
53556106 |
T |
 |
| Q |
112 |
ggtttcaaataagaatcagttggttatgattttgtggagactgaaaac--nnnnnnnggacagacacaatttcaaggccattgactctaagccagttttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53556107 |
ggtttcaaataagaatcagttggttatgattttgtggagactgaaaacaaaaaaaaaggacagacacaatttcaaggccattgactctaagccagttttt |
53556206 |
T |
 |
| Q |
210 |
ctatctttcatcacctgctgatccttagtcaacacaaatccaa |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53556207 |
ctatctttcatcacctgctgatccttagtcaacacaaatccaa |
53556249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University