View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14586_low_26 (Length: 278)
Name: NF14586_low_26
Description: NF14586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14586_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 14056900 - 14056642
Alignment:
| Q |
1 |
aaagaaagaattaagaattttcggggcatccttataattaaaaaatatagtttaggggcaccaccatgcaaatatcataaatttacacatggtggtggtc |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14056900 |
aaagaaggaattaagaattttcggggcatcctta------aaaaatatagtttaggggcaccaccatgcaaatatcataaatttacacatggtggtggtc |
14056807 |
T |
|
| Q |
101 |
atgatgcaagggatgggcgtggatgaggaatttgattacctgcaagaactgaatagtcacctgttaggggaataccttccgtttagatgtaacttgaata |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14056806 |
atgatgcaatggatgggcgtggatgaggaatttgattacacgcaagaactgaatagtcacctgttaggggaataccttccgtttagatgtaagttgaata |
14056707 |
T |
|
| Q |
201 |
ctagtggaacgagcatttgactttgtcactccaaatacagtaacatattattaagtgtttgaggg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14056706 |
ctagtggaacgagcatttgactttgtcactccaaatacagtaacatattattaagtgtttgaggg |
14056642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University