View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14586_low_41 (Length: 227)
Name: NF14586_low_41
Description: NF14586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14586_low_41 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 46641001 - 46640783
Alignment:
| Q |
7 |
gaattcaactatgagtaattgagtatatgtttatgtatatataactatgtgtgcaatgacacactcataagaattaacaaccccaatatttgttctcaaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
46641001 |
gaattcaactatgagtaattgagtatatgtttatgtatatataactatgtgtgcaatgacacactca--agaattaacaaccataatatttgttctcaaa |
46640904 |
T |
 |
| Q |
107 |
ttcaaaacaaagttgcctgaccaaccttcaatccaaacggttaaaatggaaatagctaaattcttataatttatttttacatatatgaccaattaaacac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46640903 |
ttcaaaacaaagttgcctgaccaaccttcaatccaaacggttaaaatggaaatagctaaattcttataatttatttttacatatatgaccaattaaacac |
46640804 |
T |
 |
| Q |
207 |
tacctctaattctcttacgta |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
46640803 |
tacctctaattctcttacgta |
46640783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University