View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14586_low_42 (Length: 224)
Name: NF14586_low_42
Description: NF14586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14586_low_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 43 - 209
Target Start/End: Original strand, 29935981 - 29936146
Alignment:
| Q |
43 |
caagaagaaaggtcgaggaaggtttcatgtggttttgttactttagatgttaaattattgaattgaatttgcatctgtggttgttgattagttgccacaa |
142 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29935981 |
caagaagaaaggtcgtggaaggtttcatgtggttttgttactttagatgttaaattattgaattgaatttgcatcagtggttgttgattagttgccacaa |
29936080 |
T |
|
| Q |
143 |
agttggaatttgaatatgttcagtcaacgttgccactaaggcttttgtggacttttcacctcctttg |
209 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29936081 |
agttggaa-ttgaatatgttcagtcagcgttgccactaaggcttttgtggacttttcacctcctttg |
29936146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University