View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14586_low_44 (Length: 217)
Name: NF14586_low_44
Description: NF14586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14586_low_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 16 - 198
Target Start/End: Original strand, 6202649 - 6202824
Alignment:
| Q |
16 |
gagatgaagcaaaaatgtgttaaggtatagagagaacagagaagagagtaaggtgggtatatataaatggtgaaaatgtaaatttcggcgtggaaacggc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6202649 |
gagatgaagcaaaaatgtgttaaggtatagagag-------aagagagtaaggtgggtatatataaatggtgaaaatgtaaatttcggcgtggaaacggc |
6202741 |
T |
 |
| Q |
116 |
tgagagggacagacaccaaggttcaagttgagctgtcttgtagatttgtactgctgtcttacaattaacaattataacatgtg |
198 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6202742 |
tgagagggacagacaccgaggttcaagttgagctgtcttgtagatttgtactgctgtcttacaattaacaattatagcatgtg |
6202824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University