View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14587_high_13 (Length: 227)
Name: NF14587_high_13
Description: NF14587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14587_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 8 - 210
Target Start/End: Complemental strand, 18804724 - 18804513
Alignment:
| Q |
8 |
cgagtgagatgaatggttcttatgaggcttaatgtgacatgaatagtatctttaaggcggagtatctttgttttaagtgatctctctagtcttaag---- |
103 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18804724 |
cgagtgaattgaatggttcttatgaggcttaatgtgacatgaatagtatctttaaggcggagtatctttgttttaagtgatctctctagtcttaagcgtc |
18804625 |
T |
 |
| Q |
104 |
-----tgaacatcaataccggtcttgagtgacaaaaattttggtcaaattttacttatcttctaataaccggtgttttacttgaaaccaattttattatt |
198 |
Q |
| |
|
||| |||||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18804624 |
ttaattgatcatcaatatcagtcttgagtgacaaaaattttgatcaaattttacttatcttctaataaccggtgttttacttgaaaccaattttattatt |
18804525 |
T |
 |
| Q |
199 |
aatgactatttt |
210 |
Q |
| |
|
|||||||||||| |
|
|
| T |
18804524 |
aatgactatttt |
18804513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University