View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14587_high_7 (Length: 311)
Name: NF14587_high_7
Description: NF14587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14587_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 172 - 295
Target Start/End: Complemental strand, 32497122 - 32496998
Alignment:
| Q |
172 |
gaaatttatgaaaacacaaacatagagtgaaaccaaaaccgcagcaaaaaa-catcatcatcttctacttctctccgtaacaacaacgttgttgcgtgac |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32497122 |
gaaatttatgaaaacacaaacatagagtgaaaccaaaaccgcagcaaaaaaacatcatcatcttctacttctctccgtaacaacaacgttgttgcgtgtc |
32497023 |
T |
|
| Q |
271 |
gaacaacaatgaactccactacttt |
295 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32497022 |
gaacaacaatgaactccactacttt |
32496998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 102
Target Start/End: Complemental strand, 32497229 - 32497199
Alignment:
| Q |
72 |
gaccaaataattatccacaatcacttttgtc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32497229 |
gaccaaataattatccacaatcacttttgtc |
32497199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University