View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14587_low_11 (Length: 296)

Name: NF14587_low_11
Description: NF14587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14587_low_11
NF14587_low_11
[»] chr8 (1 HSPs)
chr8 (7-242)||(38680611-38680840)


Alignment Details
Target: chr8 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 7 - 242
Target Start/End: Complemental strand, 38680840 - 38680611
Alignment:
7 gagatctcaacaatagtttctcattcacatgtcatgggttcattagaatatggtaaagccaaggttcacccatgaataaacacataacacttaaacaatt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38680840 gagatctcaacaatagtttctcattcacatgtcatgggttcattagaatatggtaaagccaaggttcacccatgaataaacacataacacttaaacaatt 38680741  T
107 acacaattacttgnnnnnnntgcatgcttacttgacagatctaatctcgtttctattccattttaactcggaacacatcatggaatgtgataaatattca 206  Q
    |||||||||||||       |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
38680740 acacaattacttgaaaaaaatgcatgcttacttgacagttctaatctcgtttctattccattttaactccgaacacatcatggaatgtgataaatattca 38680641  T
207 ctccggctctgtttggataagctgaaactaacggaa 242  Q
          ||||||| |||||||||| |||||||||||    
38680640 ------ctctgttcggataagctggaactaacggaa 38680611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University