View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14587_low_17 (Length: 223)

Name: NF14587_low_17
Description: NF14587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14587_low_17
NF14587_low_17
[»] chr1 (1 HSPs)
chr1 (1-206)||(46762963-46763168)


Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 46762963 - 46763168
Alignment:
1 aaagttttttaatttcaaaagcaaatgtgaagatattcaagcagatgctgttgtttatggaggttagtatctttgttttttcttcaaaattcacttttta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46762963 aaagttttttaatttcaaaagcaaatgtgaagatattcaagcagatgctgttgtttatggaggttagtatctttgttttttcttcaaaattcacttttta 46763062  T
101 atagtgatcaatttcaacaatttattcttcaattattatctttgttgaataataagttagattgctacaatttcttggcatccaaataaactcagttact 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46763063 atagtgatcaatttcaacaatttattcttcaattattatctttgttgaataataagttagattgctacaatttcttggcatccaaataaactcagttact 46763162  T
201 gttttc 206  Q
    ||||||    
46763163 gttttc 46763168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University