View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14588_low_12 (Length: 257)
Name: NF14588_low_12
Description: NF14588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14588_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 97 - 247
Target Start/End: Original strand, 8071567 - 8071717
Alignment:
| Q |
97 |
ttaaactaaatatcaataaaccctaataatgatacgtgtcaagagccaagggaatgtggatttagaaataaattccttggattgatttgaagcagctagc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8071567 |
ttaaactaaatatcaataaaccctaataatgatacgtgtcaagagccaagggaatgtggatttagaaataaattccttggattgatttgaagcagctagc |
8071666 |
T |
|
| Q |
197 |
gacacacaaattaatttttctctctatcgtctctataaatcttcacattca |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8071667 |
gacacacaaattaatttttctctctatcgtctctataaatcttcacattca |
8071717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 5 - 62
Target Start/End: Original strand, 8071477 - 8071534
Alignment:
| Q |
5 |
tctattttctcaatataatgtagaagtaatatatttaaactaaatctttttgcttctt |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8071477 |
tctattttctcaatataatgtagaagtaatatatttaaactaaatctttttgtttctt |
8071534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University